circad | circRNAs associated with diseases

hsa_circ_0005075
Gene	EIF4G3	Organism	Human
Genome Locus	chr1:21377358-21415706:-	Build	hg19
Disease	Liver Cell Carcinoma	ICD-10	Malignant neoplasm of Liver, unspecified (C22.9)
DBLink	Link to database	PMID	27258521
Experimental Method
Sample Type	Tissues	Comparison	66 tissue samples were obtained from 33 patients (6 females and 27 males), including 33 histopathological confirmed HCC tissues and 33 normal liver tissues
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCTACCCCATCCCCTTATTC Reverse ACCGTGCTGTAGACTGCTGAG	Statistics	Fold Change : Upregulated pvalue : p=0.042
Citation
Shang, X, Li, G, Liu, H, Li, T, Liu, J, Zhao, Q, Wang, C (2016). Comprehensive Circular RNA Profiling Reveals That hsa_circ_0005075, a New Circular RNA Biomarker, Is Involved in Hepatocellular Crcinoma Development. Medicine (Baltimore), 95, 22:e3811.